ID: 1004144026_1004144038

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1004144026 1004144038
Species Human (GRCh38) Human (GRCh38)
Location 6:13047921-13047943 6:13047954-13047976
Sequence CCCACCAAGAGTAATCCCAGGTT CTGGGGTTCAGAACACCATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!