ID: 1004154838_1004154851

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1004154838 1004154851
Species Human (GRCh38) Human (GRCh38)
Location 6:13158382-13158404 6:13158429-13158451
Sequence CCCCCTTGTCCTCCCATATAGCC CAGATTTATGTCTCTATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 160, 4: 4030} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!