ID: 1004165734_1004165740

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1004165734 1004165740
Species Human (GRCh38) Human (GRCh38)
Location 6:13255200-13255222 6:13255248-13255270
Sequence CCACACACTTTTAAACAACCAGA GGAGAACAACACCAAGGGGAAGG
Strand - +
Off-target summary {0: 586, 1: 1151, 2: 1923, 3: 1866, 4: 1874} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!