ID: 1004193946_1004193957

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1004193946 1004193957
Species Human (GRCh38) Human (GRCh38)
Location 6:13487582-13487604 6:13487617-13487639
Sequence CCAGGCCGGCTCAGGCTCTGGGA GAGGGCGGAGTTGGCGAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 317} {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!