ID: 1004205467_1004205477

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1004205467 1004205477
Species Human (GRCh38) Human (GRCh38)
Location 6:13587846-13587868 6:13587875-13587897
Sequence CCAAAGGGAAGGTGAACTGGGGG GGTAGGCTTTGGGGTCCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!