ID: 1004210530_1004210534

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1004210530 1004210534
Species Human (GRCh38) Human (GRCh38)
Location 6:13637548-13637570 6:13637564-13637586
Sequence CCTGAATTTGTCCTTATAACTTT TAACTTTACTAGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!