ID: 1004211100_1004211103

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1004211100 1004211103
Species Human (GRCh38) Human (GRCh38)
Location 6:13645283-13645305 6:13645328-13645350
Sequence CCAGGAAGAGTGGAGATTCTCTA CTCAAATATATGTATTTCAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 42, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!