ID: 1004222271_1004222279

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1004222271 1004222279
Species Human (GRCh38) Human (GRCh38)
Location 6:13757042-13757064 6:13757089-13757111
Sequence CCTGTAATCCCAGCACTTTGGGA TCAGGAGTTTGAGACCAGCCTGG
Strand - +
Off-target summary No data {0: 43634, 1: 117193, 2: 177357, 3: 203073, 4: 129438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!