|
Left Crispr |
Right Crispr |
| Crispr ID |
1004226933 |
1004226937 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:13794082-13794104
|
6:13794122-13794144
|
| Sequence |
CCTACCTGCTTCTTTATATGTGT |
TTTTTTTTTTCCATAGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 36, 4: 310} |
{0: 8, 1: 61, 2: 955, 3: 8384, 4: 39621} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|