ID: 1004246327_1004246329

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1004246327 1004246329
Species Human (GRCh38) Human (GRCh38)
Location 6:13980152-13980174 6:13980167-13980189
Sequence CCAACAAAGGGGACCTAACCCAT TAACCCATCACACTTTTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 68} {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!