ID: 1004280529_1004280535

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1004280529 1004280535
Species Human (GRCh38) Human (GRCh38)
Location 6:14276060-14276082 6:14276091-14276113
Sequence CCTGGAGCTTGATCCCACAGGGA AGACACTTTAGAACATGCCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!