ID: 1004290143_1004290148

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1004290143 1004290148
Species Human (GRCh38) Human (GRCh38)
Location 6:14359281-14359303 6:14359311-14359333
Sequence CCGTATGTAGTAATGCTCCCCAT CTTGGTCAACACTTATATAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!