ID: 1004338227_1004338232

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1004338227 1004338232
Species Human (GRCh38) Human (GRCh38)
Location 6:14783826-14783848 6:14783846-14783868
Sequence CCGGGGCTTGCGGGCCGGCCGGC GGCTTGCCGTTCCGAGTGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 17, 3: 206, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!