ID: 1004373743_1004373755

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1004373743 1004373755
Species Human (GRCh38) Human (GRCh38)
Location 6:15074549-15074571 6:15074596-15074618
Sequence CCGGCGGTCCCCAACCTTTTTGG ATAATTTTTCCACAGATGGAGGG
Strand - +
Off-target summary {0: 35, 1: 211, 2: 351, 3: 263, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!