ID: 1004373745_1004373758

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1004373745 1004373758
Species Human (GRCh38) Human (GRCh38)
Location 6:15074557-15074579 6:15074601-15074623
Sequence CCCCAACCTTTTTGGCACCAGCG TTTTCCACAGATGGAGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 30, 3: 127, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!