ID: 1004395456_1004395462

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1004395456 1004395462
Species Human (GRCh38) Human (GRCh38)
Location 6:15244018-15244040 6:15244060-15244082
Sequence CCCCACAGGTTTGATCACCACTA GACAAGCTCAGAGAGGCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 81} {0: 1, 1: 0, 2: 1, 3: 19, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!