ID: 1004397377_1004397382

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1004397377 1004397382
Species Human (GRCh38) Human (GRCh38)
Location 6:15257487-15257509 6:15257515-15257537
Sequence CCGTTGGTTGATAGTTACCACTA TTGACTCATCTCTTCGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!