ID: 1004423552_1004423561

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1004423552 1004423561
Species Human (GRCh38) Human (GRCh38)
Location 6:15492491-15492513 6:15492543-15492565
Sequence CCTCCATTCTTCTGTTTCCTTTT CAAGTCCAGGCCAGGAAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 205, 4: 1764} {0: 1, 1: 0, 2: 3, 3: 167, 4: 995}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!