ID: 1004426326_1004426337

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1004426326 1004426337
Species Human (GRCh38) Human (GRCh38)
Location 6:15509644-15509666 6:15509697-15509719
Sequence CCTTTGCCTCCGGAAGAAGAGCG CTGTGGCATGGCCTGTGTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!