ID: 1004437782_1004437793

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1004437782 1004437793
Species Human (GRCh38) Human (GRCh38)
Location 6:15613818-15613840 6:15613865-15613887
Sequence CCATTTACAGCCTGCACACAACC TCTCTCAAACTATGGTCCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!