|
Left Crispr |
Right Crispr |
| Crispr ID |
1004441501 |
1004441504 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:15659501-15659523
|
6:15659524-15659546
|
| Sequence |
CCAGGGCCATGTTTTTTCATTTT |
TTCTTTCTTTTTTAAGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 89, 4: 1174} |
{0: 2, 1: 56, 2: 870, 3: 3937, 4: 16411} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|