ID: 1004502896_1004502899

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1004502896 1004502899
Species Human (GRCh38) Human (GRCh38)
Location 6:16224964-16224986 6:16224987-16225009
Sequence CCTGACAAGCATCAAAATACAGA GAAATAGGCCCTCAGTAAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!