ID: 1004506182_1004506188

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1004506182 1004506188
Species Human (GRCh38) Human (GRCh38)
Location 6:16248727-16248749 6:16248778-16248800
Sequence CCTCACCCTTTCCCTGCTCTGCT TATGTGTTAGTATAAAAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 124, 4: 1008} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!