ID: 1004512439_1004512448

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1004512439 1004512448
Species Human (GRCh38) Human (GRCh38)
Location 6:16294032-16294054 6:16294074-16294096
Sequence CCTGTGTTACCCAAGTAACAATC CTTTGTGAAGAGAGGGACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 82} {0: 1, 1: 0, 2: 2, 3: 12, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!