ID: 1004516361_1004516368

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1004516361 1004516368
Species Human (GRCh38) Human (GRCh38)
Location 6:16325509-16325531 6:16325534-16325556
Sequence CCAATCCTAAACCCGTTTACCCT CTCCCATGAAACCACAATAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 24, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!