ID: 1004516715_1004516723

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1004516715 1004516723
Species Human (GRCh38) Human (GRCh38)
Location 6:16327398-16327420 6:16327432-16327454
Sequence CCTCCCGAGGGACAAAGTGGCTG GTATTGCATGACGACCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90} {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!