ID: 1004545803_1004545810

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1004545803 1004545810
Species Human (GRCh38) Human (GRCh38)
Location 6:16597191-16597213 6:16597234-16597256
Sequence CCGGTGGAAGGAGGAGAATTCCT TCGTCAGCCGCAAGAATCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207} {0: 1, 1: 0, 2: 1, 3: 1, 4: 21}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!