ID: 1004560082_1004560084

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1004560082 1004560084
Species Human (GRCh38) Human (GRCh38)
Location 6:16741285-16741307 6:16741299-16741321
Sequence CCACTGCACATGGTCTGGATAAC CTGGATAACTGTGGTTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 291} {0: 1, 1: 0, 2: 2, 3: 15, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!