ID: 1004571612_1004571615

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1004571612 1004571615
Species Human (GRCh38) Human (GRCh38)
Location 6:16851228-16851250 6:16851265-16851287
Sequence CCTCAAAAATATGATTTGCTATT CACTGTGTATGCATGGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!