ID: 1004634993_1004634995

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1004634993 1004634995
Species Human (GRCh38) Human (GRCh38)
Location 6:17458261-17458283 6:17458277-17458299
Sequence CCAGCAATCAGGCTACCAGGATA CAGGATAAAGAGAAAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117} {0: 1, 1: 1, 2: 27, 3: 213, 4: 1863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!