ID: 1004734266_1004734271

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1004734266 1004734271
Species Human (GRCh38) Human (GRCh38)
Location 6:18389187-18389209 6:18389227-18389249
Sequence CCCATTCTCATGAATGGTTTCAG GGCATTCAGGCTTCCAAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198} {0: 1, 1: 0, 2: 2, 3: 9, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!