ID: 1004884183_1004884192

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1004884183 1004884192
Species Human (GRCh38) Human (GRCh38)
Location 6:20036106-20036128 6:20036155-20036177
Sequence CCCTGTGGTTGCTCAGAGGCAAA GATTCAGAGGTCTCTGGGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!