ID: 1004886801_1004886806

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1004886801 1004886806
Species Human (GRCh38) Human (GRCh38)
Location 6:20059049-20059071 6:20059080-20059102
Sequence CCTAGAAATAGTGTTGGGGGAAA AGAGAGGTTCCCCCATGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!