ID: 1004942968_1004942972

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1004942968 1004942972
Species Human (GRCh38) Human (GRCh38)
Location 6:20580614-20580636 6:20580638-20580660
Sequence CCTTTATTTTTAATTACCAAACT CCCTCTCCAGGTTATAAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 669} {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!