ID: 1004947263_1004947267

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1004947263 1004947267
Species Human (GRCh38) Human (GRCh38)
Location 6:20629723-20629745 6:20629738-20629760
Sequence CCATCCCATTGTGCCGCAGCTCT GCAGCTCTGTCACCCTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 223} {0: 1, 1: 0, 2: 3, 3: 37, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!