ID: 1004950714_1004950722

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1004950714 1004950722
Species Human (GRCh38) Human (GRCh38)
Location 6:20668102-20668124 6:20668136-20668158
Sequence CCCTTCCTTCCTCCAATTGTGTA TTCCATATGGATATATACAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 29, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!