ID: 1004955380_1004955390

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1004955380 1004955390
Species Human (GRCh38) Human (GRCh38)
Location 6:20723048-20723070 6:20723088-20723110
Sequence CCCATCAACTGCAGGTACCCAGA CCTTTGCCCTTTCCAGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 14, 3: 58, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!