ID: 1004955887_1004955890

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1004955887 1004955890
Species Human (GRCh38) Human (GRCh38)
Location 6:20727164-20727186 6:20727177-20727199
Sequence CCTTGACCCACAGGTAACTGTTT GTAACTGTTTCCTTAACTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 205} {0: 1, 1: 2, 2: 3, 3: 21, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!