|
Left Crispr |
Right Crispr |
| Crispr ID |
1004963208 |
1004963211 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:20816132-20816154
|
6:20816146-20816168
|
| Sequence |
CCTTTTTTTTTTAAGGACAACAG |
GGACAACAGTCATTGGATTAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 14, 3: 126, 4: 848} |
{0: 4, 1: 48, 2: 197, 3: 467, 4: 794} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|