ID: 1004963704_1004963712

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1004963704 1004963712
Species Human (GRCh38) Human (GRCh38)
Location 6:20822611-20822633 6:20822640-20822662
Sequence CCCCATGTGTCACGGGAGAGTCC AGGTAAATGAATTATGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 192, 3: 1035, 4: 2275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!