ID: 1004965848_1004965850

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1004965848 1004965850
Species Human (GRCh38) Human (GRCh38)
Location 6:20850208-20850230 6:20850228-20850250
Sequence CCAATAAATTGTAGTACTAGGTT GTTTAAAGCCACTCTGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148} {0: 1, 1: 0, 2: 1, 3: 28, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!