ID: 1005002228_1005002242

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1005002228 1005002242
Species Human (GRCh38) Human (GRCh38)
Location 6:21253536-21253558 6:21253581-21253603
Sequence CCCACCACCACCACATGGTCCTA CAAGTGGCACAAAGAGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!