ID: 1005007189_1005007193

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1005007189 1005007193
Species Human (GRCh38) Human (GRCh38)
Location 6:21299266-21299288 6:21299297-21299319
Sequence CCTACTGTCAAGGATATACCTAT GATTCCTATTTTTAACTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!