ID: 1005121093_1005121101

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1005121093 1005121101
Species Human (GRCh38) Human (GRCh38)
Location 6:22389986-22390008 6:22390036-22390058
Sequence CCCGGGAGCTTGGCAGGCTTAGG ATCTGCGCAGCTCCAGGGTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!