ID: 1005124414_1005124419

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1005124414 1005124419
Species Human (GRCh38) Human (GRCh38)
Location 6:22429981-22430003 6:22430031-22430053
Sequence CCGTGAGCCCACGCAGAGCTCTG CTTTCTGACATTTTCTTGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!