ID: 1005140479_1005140489

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1005140479 1005140489
Species Human (GRCh38) Human (GRCh38)
Location 6:22626218-22626240 6:22626256-22626278
Sequence CCAACCTTGTCCAACCCGCTGCC GCCCAGGATGGCTTTGAATGTGG
Strand - +
Off-target summary No data {0: 225, 1: 340, 2: 474, 3: 362, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!