ID: 1005224969_1005224974

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1005224969 1005224974
Species Human (GRCh38) Human (GRCh38)
Location 6:23632164-23632186 6:23632184-23632206
Sequence CCAACAACAGTGTGAAGACACCA CCATTGGCTGTCCCTCTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!