ID: 1005279604_1005279607

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1005279604 1005279607
Species Human (GRCh38) Human (GRCh38)
Location 6:24258924-24258946 6:24258957-24258979
Sequence CCCTTTGTTCTCTAGAACACATC ACTAAAGGCTGCAATCTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!