ID: 1005286175_1005286180

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1005286175 1005286180
Species Human (GRCh38) Human (GRCh38)
Location 6:24329436-24329458 6:24329476-24329498
Sequence CCATTGCTATCCTATTTCATTTC CTGCAATCCCAAAATTATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 553} {0: 1, 1: 0, 2: 1, 3: 21, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!