ID: 1005287123_1005287126

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1005287123 1005287126
Species Human (GRCh38) Human (GRCh38)
Location 6:24339688-24339710 6:24339721-24339743
Sequence CCATTATGATTTTATAATTCTGT AGAGTAATTACATGGTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 886} {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!